Octreotide Therapy for Tumor-Induced Osteomalacia
Jochen Seufert, M.D., Katja Ebert, M.D., Justus Müller, M.D., Jochen Eulert, M.D., Christian Hendrich, M.D., Edgar Werner, M.D., Norbert Schütze, Ph.D., Georg Schulz, M.D., Werner Kenn, M.D., Hubert Richtmann, M.D., Klaus-Dieter Palitzsch, M.D., and Franz Jakob, M.D.
Tumor-induced osteomalacia (also known as oncogenic osteomalacia)1 is a rare disorder characterized by phosphaturia, hypophosphatemia, and osteomalacia mimicking the clinical phenotype of either X-linked2 or autosomal dominant3 hereditary hypophosphatemic rickets. Tumor-induced osteomalacia develops because of tumors that are predominantly of benign mesenchymal origin4 but that may occasionally be malignant, as was recently reported.5 Surgical removal of the tumor relieves all symptoms. Hemangiopericytoma is the most dominant histologic entity in tumor-induced osteomalacia.4,6 Paraneoplastic secretion by the tumor of an unknown factor or factors termed "phosphatonins" causing renal tubular phosphate wasting has been proposed as the pathogenic mechanism.7
We describe an adult man who had hypophosphatemic osteomalacia for several years before an octreotide scan revealed a mesenchymal tumor in his left thigh. Moreover, subcutaneous administration of octreotide, a synthetic somatostatin analogue, abolished renal tubular phosphate wasting before subsequent surgical removal of the tumor.
Case Report
A 50-year-old man presented with chronic pain of the spine, ribs, femurs, and tibias. The clinical examination was otherwise normal. There was no family history of metabolic bone disease.
The initial evaluation in July 1997 revealed elevated urinary phosphorus excretion, low serum phosphorus levels, and elevated serum alkaline phosphatase and osteocalcin levels. The serum values for calcium, parathyroid hormone, 25-hydroxyvitamin D3, and calcitonin were normal; the serum value for 1,25-dihydroxyvitamin D3 was inappropriately low (6.9 pg per milliliter; normal range, 35 to 80). The diagnostic evaluation at this time provided no evidence of tumor. Multiple rib fractures were identified. A bone scan with technetium-99mlabeled 2,3-dicarboxypropane-1,1-diphosphonate showed a pattern of focal, late-phase enhancement in the spine and ribs; this was suggestive of metabolic bone disease. The patient was given the diagnosis of idiopathic hypophosphatemic osteomalacia with renal phosphate wasting. Continuous oral supplementation with phosphate and 1,25-dihydroxyvitamin D3 (1.25 µg per day) was initiated. Three years after the initial diagnosis, progressive metabolic bone disease prompted another extensive evaluation.
Methods
Assays
Serum, plasma, and urinary constituents were measured by standard techniques. Hormone measurements were performed with the use of commercial immunoassay kits. Assays of serum parathyroid hormone, 25-hydroxyvitamin D3, 1,25-dihydroxyvitamin D3, and calcitonin were performed with commercial kits (DPC Biermann, Bad Nauheim, Germany), as were those for osteocalcin (Diagnostic Systems Laboratories, Sinsheim, Germany) and urinary type I collagen C-telopeptides (Beckmann Coulter, Krefeld, Germany). For calculation of renal clearance of phosphate, serum and urinary concentrations of phosphorus were determined together with the excreted urinary volume during two one-hour collection periods (Table 1).
Table 1. Laboratory Findings in a Patient with Renal Tubular Phosphate Wasting and Vitamin DResistant Osteomalacia before and 10 Days after Octreotide Therapy and 18 Months after Surgical Removal of the Tumor.
Values for the threshold for renal tubular reabsorption of phosphate were derived from the nomogram provided by Walton and Bijvoet.8 The excreted urinary volume was quantified during a two-hour collection period in the morning, and urinary phosphate and creatinine levels were determined.
Imaging Studies and Octreotide Therapy
We performed nuclear magnetic resonance, angiographic, and scintigraphic studies using octreotide labeled with indium-111 as a tracer according to standard techniques. Before surgery, unlabeled octreotide (Sandostatin, Novartis Pharma, Nuremburg, Germany) was administered subcutaneously at a dose of 50 µg three times a day for five days and then at a dose of 100 µg three times a day for eight days.
Expression of Somatostatin-Receptor Subtypes
Expression of messenger RNA (mRNA) for somatostatin-receptor subtypes in tumor samples was analyzed by the reverse-transcriptasepolymerase chain reaction (RT-PCR). Total RNA was extracted from tumor tissue by a modified single-step technique (Trizol, GIBCO, Life Technologies, Gaithersburg, Md.). RNA was reverse transcribed with use of oligo-dT12-18 primers with reverse transcriptase (Superscript, GIBCO, Life Technologies). For PCR reactions, the following oligonucleotides specific for human somatostatin receptor subtypes 1, 2, 3, 4, and 5 were used: somatostatin receptor subtype 1 (318-bp PCR product), sense primer, 5'ATGGTGGCCCTCAAGGCCGG3', antisense primer, 5'CGCGGTGGCGTAATAGTCAA3'; somatostatin receptor subtype 2 (318-bp PCR product), sense primer, 5'TCCTCTGGAATCCGAGTGGG3', antisense primer, 5'TTGTCCTGCTTACTGTCACT3'; somatostatin receptor subtype 3 (332-bp PCR product), sense primer, 5'TGCCACCCTGGGCAACGTGT3', antisense primer, 5'CAGGCAGAATATGCTGGTGA3'; somatostatin receptor subtype 4 (323-bp PCR product), sense primer, 5'GCGCGCGGCGACCTACCGGC3', antisense primer, 5'GCCTGGTGATTTTCTTCTCC3'; and somatostatin receptor subtype 5 (259-bp PCR product), sense primer, 5'CTGGTGGGGCCGGCGCCCTC3', antisense primer, 5'CCAGGCGGCACAGGACGGGG3'. The cycling conditions for the PCR reactions were 1 cycle at 94°C for 2 minutes and 28 cycles at 94°C for 30 seconds, 62°C for 30 seconds, and 72°C for 45 seconds. The identity of the PCR products was confirmed by sequencing (data not shown).
Expression of mRNA for Matrix Extracellular Phosphoglycoprotein and Fibroblast Growth Factor 23
Expression of mRNA for matrix extracellular phosphoglycoprotein and fibroblast growth factor 23 in tumor samples was analyzed by RT-PCR. The PCR conditions for matrix extracellular phosphoglycoprotein were as previously described.9
The following oligonucleotides were used for fibroblast growth factor 23: sense primer, 5'GGCGCACCCCATCAGACCATC3', and antisense primer, 5'GCCCGTTCCCCCAGCGTGCGTGTT3'. The cycling conditions for the PCR reactions were 1 cycle at 94°C for 2 minutes and 28 cycles at 94°C for 30 seconds, 60°C for 30 seconds, and 72°C for 45 seconds. The identity of the PCR products was confirmed by sequencing (data not shown).
Results
Excessive osteomalacia with osteoidosis (an excess of nonmineralized organic bone matrix) was found in a bone-biopsy specimen derived from the iliac crest. Laboratory findings are summarized in Table 1. Findings consistent with the diagnosis of renal phosphate wasting included elevated renal phosphate clearance and low serum phosphorus levels despite ongoing oral phosphate therapy. The serum level of 1,25-dihydroxyvitamin D3 was at the lower end of the normal range despite oral supplementation. The threshold for renal tubular reabsorption of phosphate, which is largely independent of oral phosphate therapy, was significantly reduced. The serum levels of alkaline phosphatase, osteocalcin, and urinary type I collagen C-telopeptides were elevated.
Since we were unable to locate a tumor, an octreotide scan was performed that showed circumscript pooling of radioactive octreotide tracer in the left thigh (Figure 1A). Magnetic resonance imaging and angiography revealed a well-vascularized mass of 5.5 by 4.5 by 3.0 cm within the laterodorsal section of the vastus lateralis muscle (Figure 1B).
Figure 1. Imaging Studies in a Patient with Tumor-Induced Osteomalacia.
Panel A shows scintigraphic images obtained four hours after injection of 230 MBq of octreotide labeled with indium-111. Circumscriptive pooling of radiolabeled octreotide is demonstrated within the lateral portion of the left thigh (arrows). In Panel B, nuclear magnetic resonance imaging in transverse sections (top) and longitudinal sections (bottom left) reveals a tumor with heterogeneous contrast enhancement within the laterodorsal portion of the vastus lateralis muscle in the left thigh (arrowheads). Magnetic resonance angiography (bottom right) shows highly perfused arterial and venous vessels in the tumor (arrowhead). R denotes right, L left, V ventral, and D dorsal.
While the patient awaited surgical resection of the tumor, a trial of subcutaneous octreotide was initiated and continued for 13 days (50 µg three times a day on days 1 through 5 and 100 µg three times a day on days 6 through 13). Octreotide therapy led to normalization of serum phosphorus levels, phosphate clearance, and the threshold for renal tubular reabsorption of phosphate by day 10 (Table 1 and Figure 2). Serum alkaline phosphatase and osteocalcin levels were reduced, whereas urinary excretion of type I collagen C-telopeptide and serum parathyroid hormone levels were transiently increased. Serum calcium levels as well as all other values remained unchanged (Table 1).
Figure 2. Renal Phosphate Clearance and Values for Serum Phosphorus and Parathyroid Hormone in a Patient with Tumor-Induced Osteomalacia during the Initial Course of the Disease, during Octreotide Therapy before Surgical Removal of the Tumor, and after Surgical Removal of the Tumor.
The normal range of values for renal phosphate clearance (5.4 to 16.2 ml per minute) is indicated by the hatched area. The normal range of values for serum parathyroid hormone (12 to 72 pg per milliliter) is indicated by the shaded area. The normal range of values for serum phosphorus (0.87 to 1.45 mmol per liter) is indicated by the stippled area. To convert values for serum parathyroid hormone to picomoles per liter, multiply by 0.106. Doses of octreotide were administered subcutaneously three times a day.
Oral phosphate therapy was tapered as serum phosphorus levels became normal (Table 1 and Figure 2). The tumor was a hemangiopericytoma with slit-like vessels, pericytic tumor cells with elongated nuclei, crowding of the nuclear membrane, and dense chromatin surrounded by a small, elongated cytoplasmic region. Tumor cells stained positive for vimentin but were negative for smooth-muscle
Since removal of the tumor, phosphate metabolism has remained normal without further oral phosphate therapy (Figure 2).
RT-PCR analysis of tumor-derived RNA samples showed predominant expression of somatostatin receptor subtype 2 mRNA and a faint positive reaction for somatostatin receptor subtype 5 mRNA, whereas subtypes 1, 3, and 4 were absent (Figure 3). The mRNA for matrix extracellular phosphoglycoprotein8 and fibroblast growth factor 23 was abundantly expressed (Figure 4).
Figure 3. Expression of mRNA for Somatostatin Receptor Subtypes 1, 2, 3, 4, and 5 in a Tumor from a Patient with Tumor-Induced Osteomalacia.
The results of RT-PCR with oligonucleotides specific for somatostatin receptor subtypes 1, 2, 3, 4, and 5 are shown. RT denotes PCR products derived from a reverse transcription without addition of reverse transcriptase (as a control for genomic-DNA contamination in RNA extracted from the tumor). The tumor predominantly expressed mRNA for somatostatin receptor subtype 2 and (less abundantly) type 5. MW denotes the molecular-weight marker, and SSTR somatostatin-receptor subtype.
Figure 4. The mRNA Expression of Secreted Tumor Factors.
Panel A shows detection of mRNA expression for the tumor factor matrix extracellular phosphoglycoprotein (MEPE) by RT-PCR in two independent tumor samples. Panel B shows detection of mRNA expression for the phosphaturic factor fibroblast growth factor 23 (FGF-23) by RT-PCR in two independent tumor samples. The tumor expressed mRNA for both matrix extracellular phosphoglycoprotein and fibroblast growth factor 23. MW denotes the molecular-weight marker.
Clinical and laboratory evaluations 3 and 18 months after surgery revealed normalization of bone and phosphate metabolism (Table 1 and Figure 2). Another bone biopsy as well as follow-up scintigraphic imaging 18 months after surgery demonstrated resolution of all signs of metabolic bone disease and osteomalacia (data not shown).
Discussion
Tumor-induced osteomalacia with tumors that are predominantly derived from the mesenchyme is a paraneoplastic syndrome of renal phosphate wasting due to secretion of phosphaturic factors, termed phosphatonins.1 Because the tumor caused no symptoms in our patient, diagnosis of the tumor was delayed for several years. We hypothesized that tumors secreting phosphatonins may express somatostatin receptors that regulate secretory activity, as has been shown in other endocrine tumors.10,11 We were able to detect a previously unrecognized tumor by scintigraphy using octreotide labeled with indium-111, as has been done in similar cases.10,11 In addition, we were able to achieve complete preoperative remission of renal phosphate wasting in our patient by octreotide therapy through a mechanism that most likely involved suppression of phosphatonin secretion.
The finding of somatostatin receptor subtype 2 expression in the tumor provides the molecular basis for the positive octreotide scan and the clinical response to octreotide therapy (Table 1 and Figure 2), because subtype 2 displays the highest affinity for octreotide of all five somatostatin-receptor isoforms.12
Phosphate metabolism in humans is regulated by hormonally modified intestinal uptake and renal excretion, through interaction with the vitamin Dparathyroid hormonecalcium endocrine system.13 1,25-Dihydroxyvitamin D3 stimulates intestinal uptake of phosphate and inhibits renal excretion,14 whereas parathyroid hormone is phosphaturic.15 Renal phosphate excretion is regulated mainly through the activity of the renal tubular type IIa sodiuminorganic phosphate cotransporter.16 Studies of hereditary and tumor-associated phosphate-wasting disorders suggest that several other factors must be involved in the regulation of phosphate metabolism. The present view holds that the product of the PHEX gene (phosphate-regulating gene with homologies to endopeptidases on the X chromosome) is an endopeptidase that cleaves secreted phosphaturic hormonelike substances the phosphatonins.1,17 Thus, hypophosphatemic rickets may be caused by disorders of the sodiuminorganic phosphate cotransporter itself, of the phosphatonins as modifiers of renal phosphate transport, or of the endopeptidase PHEX, which cleaves phosphatonins. In support of this concept, inactivating mutations of the PHEX gene are associated with the clinical phenotype of X-linked hypophosphatemic rickets.2
The tumor-induced form of hypophosphatemic rickets (oncogenic osteomalacia) has recently been shown to be associated with overexpression of fibroblast growth factor type 23 in tumor cells, which indicates that fibroblast growth factor type 23 is one of the causative phosphatonins for this disease.18 We found ample expression of the phosphatonin fibroblast growth factor type 23 in our patient's tumor. Thus, the clinical response to octreotide therapy in this patient may suggest that secretion of fibroblast growth factor type 23 by the tumor can be modulated through the somatostatin-receptor signaling pathway. This protein has further been demonstrated to act as both a substrate for the endopeptidase PHEX and an inhibitor of phosphate transport in kidney cells.19 Moreover, in the autosomal dominant form of hypophosphatemic rickets, mutations in fibroblast growth factor type 23 have been identified that render the molecule resistant to cleavage by PHEX.3
The patient's laboratory values provided no evidence of major effects of octreotide therapy on glomerular filtration or renal perfusion through the growth hormoneinsulin-like growth factor I axis (Table 1). In patients with acromegaly who were treated with octreotide, minor increases in serum parathyroid hormone levels within the normal range have previously been reported.20 We believe, however, that the main reason for the transient overt hyperparathyroidism in our patient was the normalization of serum phosphorus levels that led to a disinhibition of secretion of parathyroid hormone (Table 1 and Figure 2), despite unchanged serum calcium levels.
We conclude that octreotide imaging is a valuable diagnostic tool in patients with phosphate wasting but with no family history and with no clinically apparent tumor. Moreover, we propose that in patients in whom surgery cannot be performed for technical reasons or because of coexisting conditions, phosphate wasting may be relieved by treatment with somatostatin analogues, given that the tumor expresses somatostatin receptors, which can easily be evaluated by octreotide scanning.
This case suggests that regulation of phosphate metabolism involves secretory mechanisms that may be modulated by somatostatin receptors. Whether this holds true only under pathologic conditions or is relevant to phosphate metabolism in normal states remains to be elucidated.
We are indebted to the patient for his collaboration in this study; to the staff of the endocrine laboratory for the hormone assays; to Sandra Royer for expert technical assistance in the expression studies; and to Günter Delling, M.D., for histopathologic evaluation of bone-biopsy specimens.
Source Information
From the Division of Endocrinology, Metabolism, and Molecular Medicine, Medizinische Poliklinik (J.S., K.E., F.J.); and the Departments of Pathology (J.M.), Orthopedic Surgery (J.E., C.H., N.S.), Nuclear Medicine (E.W.), and Radiology (G.S., W.K.), University of Würzburg both in Würzburg; the Division of Endocrinology of the Department of Internal Medicine I, University of Regensburg, Regensburg (K.-D.P.); and Tirschenreuth (H.R.) all in Germany.
Address reprint requests to Dr. Jakob at the Division of Endocrinology, Metabolism, and Molecular Medicine, Medizinische Poliklinik, University of Würzburg, Klinikstr. 6-8, 97070 Würzburg, Germany, or at jakob.medpoli@mail.uni-wuerzburg.de.
References
- Econs MJ, Drezner MK. Tumor-induced osteomalacia -- unveiling a new hormone. N Engl J Med 1994;330:1679-1681.
- The HYP Consortium. A gene (PEX) with homologies to endopeptidases is mutated in patients with X-linked hypophosphatemic rickets. Nat Genet 1995;11:130-136.
- The ADHR Consortium. Autosomal dominant hypophosphataemic rickets is associated with mutations in FGF23. Nat Genet 2000;26:345-348.
- Kumar R. Tumor-induced osteomalacia and the regulation of phosphate homeostasis. Bone 2000;27:333-338.
- Case Records of the Massachusetts General Hospital (Case 29-2001). N Engl J Med 2001;345:903-908.
- Park YK, Unni KK, Beabout JW, Hodgson SF. Oncogenic osteomalacia: a clinicopathologic study of 17 bone lesions. J Korean Med Sci 1994;9:289-298.
- Cai Q, Hodgson SF, Kao PC, et al. Inhibition of renal phosphate transport by a tumor product in a patient with oncogenic osteomalacia. N Engl J Med 1994;330:1645-1649.
- Walton RJ, Bijvoet OL. Nomogram for derivation of renal threshold phosphate concentration. Lancet 1975;2:309-310.
- Rowe PS, de Zoysa PA, Dong R, et al. MEPE, a new gene expressed in bone marrow and tumors causing osteomalacia. Genomics 2000;67:54-68.
- Rhee Y, Lee JD, Shin KH, Lee HC, Huh KB, Lim SK. Oncogenic osteomalacia associated with mesenchymal tumour detected by indium-111 octreotide scintigraphy. Clin Endocrinol (Oxf) 2001;54:551-554.
- Nguyen BD, Wang EA. Indium-111 pentetreotide scintigraphy of mesenchymal tumor with oncogenic osteomalacia. Clin Nucl Med 1999;24:130-131.
- Lamberts SWJ, van der Lely A-J, de Herder WW, Hofland LJ. Octreotide. N Engl J Med 1996;334:246-254.
- DiMeglio LA, White KE, Econs MJ. Disorders of phosphate metabolism. Endocrinol Metab Clin North Am 2000;29:591-609.
- Brown AJ, Dusso A, Slatopolsky E. Vitamin D. Am J Physiol 1999;277:F157-F175.
- Marx SJ. Hyperparathyroid and hypoparathyroid disorders. N Engl J Med 2000;343:1863-1875. [Erratum, N Engl J Med 2001;344:696.]
- Murer H, Hernando N, Forster I, Biber J. Molecular aspects in the regulation of renal inorganic phosphate reabsorption: the type IIa sodium/inorganic phosphate co-transporter as the key player. Curr Opin Nephrol Hypertens 2001;10:555-561.
- Kumar R. Phosphatonin a new phosphaturetic hormone? (Lessons from tumour-induced osteomalacia and X-linked hypophosphataemia.) Nephrol Dial Transplant 1997;12:11-3.
- Shimada T, Mizutani S, Muto T, et al. Cloning and characterization of FGF23 as a causative factor of tumor-induced osteomalacia. Proc Natl Acad Sci U S A 2001;98:6500-6505.
- Bowe AE, Finnegan R, Jan de Beur SM, et al. FGF-23 inhibits renal tubular phosphate transport and is a PHEX substrate. Biochem Biophys Res Commun 2001;284:977-981.
- Legovini P, De Menis E, Breda F, et al. Long-term effects of octreotide on markers of bone metabolism in acromegaly: evidence of increased serum parathormone concentrations. J Endocrinol Invest 1997;20:434-438.